Quick Order

Human SULT1B1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SULT1B1cDNA Clone Product Information
cDNA Size:891
cDNA Description:ORF Clone of Homo sapiens sulfotransferase family, cytosolic, 1B, member 1 DNA.
Gene Synonym:ST1B2, SULT1B2, MGC13356, SULT1B1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human SULT1B1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

Sulfotransferase family cytosolic 1B member 1, also known as Sulfotransferase 1B1, Sulfotransferase 1B2, Thyroid hormone sulfotransferase, SULT1B1 and ST1B2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1B1 is highly expressed in the liver, peripheral blood leukocytes, colon (mucosal lining), small intestine (jejunum) and spleen. A lesser expression of SULT1B1 was observed in the lung, placenta and thymus. SULT1B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT1B1 sulfates dopamine, small phenols such as 1-naphthol and p-nitrophenol and thyroid hormones, including 3,3'-diiodothyronine, triidothyronine, reverse triiodothyronine and thyroxine.

  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Kester,MH.et al., 2003,Am J Physiol Endocrinol Metab. 285 (3):E592-8.
  • Meinl W, et al., 2001, Biochem Biophys Res Commun. 288 (4): 855-62.
  • Dombrovski L. et al., 2006, Proteins 64: 1091-4.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items