After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CTSC / DPPI ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CTSC cDNA Clone Product Information
NCBI RefSeq:NM_009982.4
RefSeq ORF Size:1389bp
cDNA Description:Full length Clone DNA of Mus musculus cathepsin C with N terminal Myc tag.
Gene Synonym:DPP1, DPPI, AI047818
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cathepsins are proteases found in many types of cells conserved in all animals, which have a vital role in mammalian cellular turnover such as bone resorption. The lysosomal cysteine protease Cathepsin C (CTSC), also known as dipeptidyl peptidase I (DPPI/DPP1), activates a number of granule-associated serine proteases with pro-inflammatory and immune functions by removal of their inhibitory N-terminal dipeptides. This lysosomal exo-cysteine protease belonging to the peptidase C1 family. Active cathepsin C is found in lysosomes as a 200-kDa multimeric enzyme. Subunits constituting this assembly all arise from the proteolytic cleavage of a single precursor giving rise to three peptides: the propeptide, the alpha- and the beta-chains. It is a central coordinator for activation of many serine proteases in immune/inflammatory cells. Defects in the Cathepsin C have been shown to be a cause of Papillon-Lefevre disease, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. Cathepsin C plays a key role in the activation of several degradative enzymes linked to tissue destruction in inflammatory diseases. Thus, it is a therapeutic target for the treatment of a number of inflammatory and autoimmune diseases.

References
  • Santilman V, et al. (2002) Importance of the propeptide in the biosynthetic maturation of rat cathepsin C. Eur J Cell Biol. 81(12): 654-63.
  • Kam CM, et al. (2004) Design and evaluation of inhibitors for dipeptidyl peptidase I (Cathepsin C). Arch Biochem Biophys. 427(2): 123-34.
  • Noack B, et al. (2008) Cathepsin C gene variants in aggressive periodontitis. J Dent Res. 87(10): 958-63.
  • Laine DI, et al. (2010) Inhibitors of cathepsin C (dipeptidyl peptidase I). Expert Opin Ther Pat. 20(4): 497-506.
  • Size / Price
    Catalog: MG50007-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"