After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse ANPEP ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ANPEP cDNA Clone Product Information
Gene_bank_ref_id:NM_008486.1
RefSeq ORF Size:2901bp
cDNA Description:Full length Clone DNA of Mus musculus alanyl (membrane) aminopeptidase with N terminal Myc tag.
Gene Synonym:Apn, Cd13, Lap-1, Lap1, p150
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Aminopeptidase N (ANPEP or APN), also known as CD13, is a cell-surface metalloprotease located in the small-intestinal and renal microvillar membrane, as well as other plasma membranes. It belongs to the peptidase M1 family. CD13 plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases and is involved in the metabolism of regulatory peptides by diverse cell types. CD13/APN is a potent regulator of angiogenesis which is essential for tumor invasion and metastasis, and its transcription in activated endothelial cells is induced by angiogenic growth factors via the RAS/MAPK pathway. In addition, this enzyme has been shown to participate in antigen processing and presentation, and accordingly, defects in this gene appear to be a cause of various types of leukemia or lymphoma and carcinomas.

References
  • Pasqualini R, et al. (2000) Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis.Cancer Res. 60(3): 722-7.
  • Mabjeesh SJ, et al. (2005) Aminopeptidase N gene expression and abundance in caprine mammary gland is influenced by circulating plasma peptide. J Dairy Sci. 88(6): 2055-64.
  • Dunkel B, et al. (2009) Neutrophil and platelet activation in equine recurrent airway obstruction is associated with increased neutrophil CD13 expression, but not platelet CD41/61 and CD62P or neutrophil-platelet aggregate formation. Vet Immunol Immunopathol. 131(1-2): 25-32.
  • Size / Price
    Catalog: MG50001-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"