Quick Order

Text Size:AAA

Human ESM1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ESM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_007036.4
RefSeq ORF Size:555bp
cDNA Description:Full length Clone DNA of Homo sapiens endothelial cell-specific molecule 1 with N terminal HA tag.
Gene Synonym:ESM1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ESM1 is a secreted protein which is produced by adipocytes. It has been noticed that ESM1 may play some role in obesity-associated vascular disease since circulating ESM-1 levels are reduced in the overweight and obese. ESM1 is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of ESM1 gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. Recently, ESM1 has been described as a specific biomarker of tip cells during neoangiogenesis. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF or FGF-2. In hypervascularized cancers, overexpression of endocan has been detected by immunohistochemistry using monoclonal antibodies against ESM1.

References
  • Cong R, et al. (2006) Hhex is a direct repressor of endothelial cell-specific molecule 1 (ESM-1). Biochem. Biophys Res Commun. 346(2):535-45.
  • Aitkenhead M, et al. (2002) Identification of endothelial cell genes expressed in an in vitro model of angiogenesis: induction of ESM-1, (beta)ig-h3, and NrCAM. Microvasc Res. 63(2): 159-71.
  • Lassalle P, et al. (1996) ESM-1 is a novel human endothelial cell-specific molecule expressed in lung and regulated by cytokines. J Biol Chem. 271(34):20458-64.
  • Size / Price
    Catalog: HG11578-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"