Quick Order

Rat ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ECH1cDNA Clone Product Information
cDNA Size:984
cDNA Description:ORF Clone of Rattus norvegicus enoyl CoA hydratase 1, peroxisomal DNA.
Gene Synonym:Pxel
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

ECH1 is a member of the hydratase/isomerase superfamily. ECH1 shows high sequence similarity to enoyl-CoA hydratases of several species, particularly within a conserved domain characteristic of these proteins. ECH1 contains a C-terminal peroxisomal targeting sequence and localizes to peroxisomes. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans, 5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. ECH1 functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators.

  • Kovalyov LI, et al. (2006) Polymorphism of delta3,5-delta2,4-dienoyl-coenzyme A isomerase (the ECH1 gene product protein) in human striated muscle tissue. Biochemistry Mosc. 71(4): 448-53.
  • Olsen JV, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 127(3):635-48.
  • FitzPatrick DR, et al. (1995) Isolation and characterization of rat and human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase. Genomics. 27(3):457-66.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items