After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse SIGLEC5 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SIGLEC5 cDNA Clone Product Information
Gene_bank_ref_id:NM_145581.1
RefSeq ORF Size:1710bp
cDNA Description:Full length Clone DNA of Mus musculus sialic acid binding Ig-like lectin 5 with N terminal Flag tag.
Gene Synonym:Siglecf, mSiglec-F
Species:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SIGLEC5 contains 2 Ig-like C2-type (immunoglobulin-like) domains and 1 Ig-like V-type (immunoglobulin-like) domain. It belongs to the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. SIGLEC5 is expressed by monocytic/myeloid lineage cells. It is found at high levels in peripheral blood leukocytes, spleen, bone marrow and at lower levels in lymph node, lung, appendix, placenta, pancreas and thymus. It is also expressed by monocytes and neutrophils but absent from leukemic cell lines representing early stages of myelomonocytic differentiation. SIGLEC5 is a putative adhesion molecule that mediates sialic-acid dependent binding to cells. It binds equally to alpha-2,3-linked and alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface.

References
  • Angata T, et al. (2006) Discovery of Siglec-14, a novel sialic acid receptor undergoing concerted evolution with Siglec-5 in primates. FASEB J. 20(12):1964-73.
  • Avril T, et al. (2005) Siglec-5 (CD170) can mediate inhibitory signaling in the absence of immunoreceptor tyrosine-based inhibitory motif phosphorylation. J Biol Chem. 280(20):19843-51.
  • Erickson-Miller CL, et al. (2003) Characterization of Siglec-5 (CD170) expression and functional activity of anti-Siglec-5 antibodies on human phagocytes. Exp Hematol. 31(5):382-8.
  • Size / Price
    Catalog: MG50836-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"