Quick Order

Mouse LAMP2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LAMP2cDNA Clone Product Information
cDNA Size:1248
cDNA Description:ORF Clone of Mus musculus lysosomal-associated membrane protein 2 DNA.
Gene Synonym:Mac3, CD107b, Lamp-2, Lamp-2a, Lamp-2b, Lamp-2c, Lamp2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

LAMP2 (Lysosomal-associated membrane protein 2), also known as CD107b (Cluster of Differentiation 107b), is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. In human, LAMP2, the causative gene of Danon disease, located on chromosome Xq24, encodes the lysosome-associated membrane protein-2 (LAMP-2). LAMP-2 deficiency, or Danon disease, is a rare X-linked lysosomal disease characterized by cardiomyopathy, vacuolar myopathy, and mental retardation. LAMP2 cardiomyopathy is an X-linked and highly progressive myocardial storage disorder associated with diminished survival, which clinically resembles sarcomeric hypertrophic cardiomyopathy.

  • Maron BJ, et al. (2010) Profound left ventricular remodeling associated with LAMP2 cardiomyopathy. Am J Cardiol. 106(8): 1194-6.
  • Di Blasi C, et al. (2008) Danon disease: a novel LAMP2 mutation affecting the pre-mRNA splicing and causing aberrant transcripts and partial protein expression. Neuromuscul Disord. 18(12): 962-6.
  • Echaniz-Laguna A, et al. (2006) Novel Lamp-2 gene mutation and successful treatment with heart transplantation in a large family with Danon disease. Muscle Nerve. 33(3): 393-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks