Quick Order

Text Size:AAA

Human TAOK3 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TAOK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_016281.3
RefSeq ORF Size:2697bp
cDNA Description:Full length Clone DNA of Homo sapiens TAO kinase 3 with N terminal HA tag.
Gene Synonym:DPK, JIK, MAP3K18, FLJ31808, DKFZp666H245, TAOK3
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serine/threonine-protein kinase TAO3, also known as cutaneous T-cell lymphoma-associated antigen HD-CL-09, CTCL-associated antigen HD-CL-09, Dendritic cell-derived protein kinase, JNK / SAPK-inhibitory kinase, Jun kinase-inhibitory kinase, Kinase from chicken homolog A, Thousand and one amino acid protein 3, JIK, TAOK3 and MAP3K18, is cytoplasm and peripheral membrane protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and STE20 subfamily. Protein kinases are pivotal regulators of cell signaling that modulate each other's functions and activities through site-specific phosphorylation events. TAOK3 / JIK contains one protein kinase domain. TAOK3 / JIK is ubiquitously expressed at a low level, and highly expressed in peripheral blood leukocytes (PBLs), thymus, spleen, kidney, skeletal muscle, heart and liver. TAOK3 / JIK inhibits the basal activity of Jun kinase. It is negatively regulated by epidermal growth factor (EGF). When overexpressed, TAOK3 / JIK may activate ERK1 / ERK2 and JNK / SAPK.

References
  • Tassi E., et al., 1999, J. Biol. Chem. 274:33287-95.
  • Yoneda T., et al., 2001, J. Biol. Chem. 276:13935-40.
  • Yustein J.T., et al.,2003, Oncogene 22:6129-41.
  • Daub H., et al., 2008, Mol. Cell 31:438-48.
  • Size / Price
    Catalog: HG11547-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"