Quick Order

Human STX3 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human STX3 cDNA Clone Product Information
NCBI RefSeq:BC007405
RefSeq ORF Size:870bp
cDNA Description:Full length Clone DNA of Homo sapiens syntaxin 3 with N terminal His tag.
Gene Synonym:STX3A
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

STX3, also known as syntaxin 3, belongs to the syntaxin family. STX3 is a target membrane protein (t-SNARE) which is needed for membrane fusion. Membrane fusion requires the formation of a complex between a vesicle protein (v-SNARE) and t-SNAREs. STX3, together with syntaxin 2, are predominantly localized at the plasma membrane. Syntaxin 2 cycles between the plasma membrane and the perinuclear compartment whereas syntaxin 3 cycles between the plasma membrane and the trans-Golgi network. It is possible that this cycling has an important role in the regulation of t-SNARE function.

References
  • Ibaraki K. et al., 1995, Biochem Biophys Res Commun. 211 (3): 997-1005
  • Martín-Martín B. et al., 1999, J Leukoc Biol. 65 (3): 397-406.
  • Darios F. et al., 2006, Nature. 440 (7085): 813-7.
  • Size / Price
    Catalog: HG14625-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"