Quick Order

Text Size:AAA

Mouse CDC37 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CDC37 cDNA Clone Product Information
NCBI RefSeq:NM_016742.4
RefSeq ORF Size:1140bp
cDNA Description:Full length Clone DNA of Mus musculus cell division cycle 37 homolog (S. cerevisiae) with N terminal Flag tag.
Gene Synonym:p50, p50Cdc37, Cdc37
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent with a positive role in proliferation and is required for cell division in budding yeast. CDC37 is though to play an important role in the establishment of signaling pathways controlling cell proliferation through targeting intrinsically unstable oncoprotein kinases such as Cdk-4, Raf-1, and src to the molecular chaperone Hsp90. Decreased Hsp90 expression can reduce the levels of microtubule-associated protein tau, whose overexpression may induce many diseases. CDC37 is considered as a co-chaperone that is classified to Hsp90's accessory proteins. It has been reported that suppression of Cdc37 destabilized tau, leading to its clearance, whereas cdc37 overexpression preserved tau.Cdc37 was found to co-localize with tau in neuronal cells and to physically interact with tau from human brain. Moreover, Cdc37 levels significantly increased with age.

References
  • Dai K, et al. (1996) P hysical Interaction of Mammalian CDC37 with CDK4. The journal of biological chemistry. 271: 22030-4.
  • Pearl LH, et al. (2005) Hsp90 and Cdc37-a chaperone cancer conspiracy. Current opinion in genetics development. 15 (1): 55-61.
  • Chen GQ, et al. (2002) TNF-Induced Recruitment and Activation of the IKK Complex Require Cdc37 and Hsp90. Molecular cell. 9 (2): 401-10.
  • Size / Price
    Catalog: MG50826-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"