Quick Order

Rat NRAS Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NRAScDNA Clone Product Information
Gene_bank_ref_id:NM_080766.2
cDNA Size:570
cDNA Description:ORF Clone of Rattus norvegicus neuroblastoma ras oncogene DNA.
Gene Synonym:Nras
Species:Rat
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

NRAS was discovered by researchers at the Institute of Cancer Research, funded by the Cancer Research Campaign (now Cancer Research UK). NRAS gene is a member of the Ras gene family. It is mapped on chromosome 1, and it is activated in HL60, a promyelocytic leukemia line. The mammalian ras gene family consists of the harvey and kirsten ras genes (HRAS and KRAS), an inactive pseudogene of each (c-Hras2 and c-Kras1) and the N-ras gene. They differ significantly only in the C-terminal 40 amino acids. These ras genes have GTP/GDP binding and GTPase activity, and their normal function may be as G-like regulatory proteins involved in the normal control of cell growth. The NRAS gene specifies two main transcripts of 2Kb and 4.3Kb. The difference between the two transcripts is a simple extension through the termination site of the 2Kb transcript. The NRAS gene consists of seven exons (-I, I, II, III, IV, V, VI).

References
  • Marshall CJ. et al., 1982, Nature. 299 (5879): 171-3.
  • Hall Alan. et al., 1983, Nature. 303 (5916): 396-400.
  • McCormick F. 1996, Mol Reprod Dev. 42 (4): 500-6.
  • Size / Price
    Catalog:RG80678-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"