After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse CAR3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CA3cDNA Clone Product Information
cDNA Size:783
cDNA Description:ORF Clone of Mus musculus carbonic anhydrase 3 DNA.
Gene Synonym:Ca3; Car-3; BB219044
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Carbonic anhydrases (CAs) form a family of enzymes that catalyze the rapid conversion of carbon dioxide and water to bicarbonate and protons, a reaction that occurs rather slowly in the absence of a catalyst. The active site of most carbonic anhydrases contains a zinc ion, they are therefore classified as metalloenzymes. Several forms of carbonic anhydrase occur in nature. The primary function of the enzyme in animals is to interconvert carbon dioxide and bicarbonate to maintain acid-base balance in blood and other tissues, and to help transport carbon dioxide out of tissues. Plants contain a different form called β-carbonic anhydrase, which, from an evolutionary standpoint, is a distinct enzyme, but participates in the same reaction and also uses a zinc ion in its active site.

Carbonic anhydrase 3, also known as Carbonate dehydratase III, CA-III and CA3, is a cytoplasm protein which belongs to the alpha-carbonic anhydrase family. CA3 is activated by proton donors such as imidazole and the dipeptide histidylhistidine. It is inhibited by coumarins and sulfonamide derivatives such as acetazolamide. At 6 weeks gestation, transcripts accumulate at low levels in the somites and at high levels throughout the notochord. As gestation continues, CA3 becomes abundant in all developing muscle masses and continues at high to moderate levels in the notochord.

  • Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596-601.
  • Sowden J. et al., 1998, Gene 214:157- 65.
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899-903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40: 257-62.
  • Bataller,L. et al., 2004, Ann Neurol  56 (4): 575-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items