After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human VSIG2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VSIG2 cDNA Clone Product Information
Gene_bank_ref_id:NM_014312.3
RefSeq ORF Size:984bp
cDNA Description:Full length Clone DNA of Homo sapiens V-set and immunoglobulin domain containing 2 with N terminal HA tag.
Gene Synonym:CTH, CTXL, 2210413P10Rik, VSIG2
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

V-set and immunoglobulin domain-containing protein 2, also known as cortical thymocyte-like protein, CT-like protein and VSIG2, is a single-pass type I membrane protein which contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. VSIG2 is highly expressed in stomach, colon, prostate, trachea and thyroid glands and weakly in bladder and lung. V-set domains are Ig-like domains resembling the antibody variable domain. V-set domains are found in diverse protein families, including immunoglobulin light and heavy chains; in several T-cell receptors such as CD2 (Cluster of Differentiation 2), CD4, CD80, and CD86; in myelin membrane adhesion molecules; in junction adhesion molecules (JAM); in tyrosine-protein kinase receptors; and in the programmed cell death protein 1 (PD1).

References
  • Satow Y, et al.,1986, J. Mol. Biol. 190(4): 593-604. 
  • Kariuki,S.N. et al., 2010, Arthritis Res Ther. 12 (4):R151.
  • Size / Price
    Catalog: HG11543-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"