After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KCT2 / C5orf15 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KCT2 cDNA Clone Product Information
Gene_bank_ref_id:BC020875
RefSeq ORF Size:798bp
cDNA Description:Full length Clone DNA of Homo sapiens chromosome 5 open reading frame 15 with C terminal HA tag.
Gene Synonym:HTGN29, KCT2, C5orf15
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

KCT2, also known as C5orf15, KCT2 gene maps to human chromosome 5q31.1 and is conserved in human, chimpanzee, cow, rat, and chicken. KCT2 is a 265 amino acid single-pass type I membrane protein that is widely expressed. Chromosome 5 is associated with Cockayne syndrome through the ERCC8 gene and familial adenomatous polyposis through the adenomatous polyposis coli (APC) tumor suppressor gene. Chromosome 5 contains 181 million base pairs and comprises nearly 6% of the human genome.

Size / Price
Catalog: HG13794-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"