Quick Order

Human GPD1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPD1 cDNA Clone Product Information
Gene_bank_ref_id:BC032234
RefSeq ORF Size:1050bp
cDNA Description:Full length Clone DNA of Homo sapiens glycerol-3-phosphate dehydrogenase 1 (soluble) with C terminal His tag.
Gene Synonym:GPD-C, HTGTI, GPDH-C
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

GPD1, also known as glycerolphosphate dehydrogenase 1, is a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. GPD1 catalyzes the reversible redox conversion of dihydroxyacetone phosphate (DHAP), thus plays a critical role in carbohydrate and lipid metabolism. It also reduces nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. Meanwhile, GPD1 and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in GPD1 gene are a cause of transient infantile hypertriglyceridemia.

References
  • Ou X. et al., 2006, J Mol Biol. 357 (3): 858-69.
  • Ou Xianjin. et al., 2011, Journal of Molecular Biology. 357 (3): 858-69.
  • Harding Jr. et al., 1975, Biochem Journal. 146: 223-9.
  • Size / Price
    Catalog: HG15489-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"