Quick Order

Text Size:AAA

Human ENPP5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENPP5cDNA Clone Product Information
cDNA Size:1434
cDNA Description:ORF Clone of Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) DNA.
Gene Synonym:KIAA0879, ENPP5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

ENPP5 is a member of the nucleotide pyrophosphatase/phosphodiesterase family(NPP). It is a family comprised by dimeric enzymes that catalyze the hydrolysis of phosphate diester bonds. There are seven isoforms in NPP family, some of which prefer nucleotide substrates, some of which prefer phospholipid substrates, and others of which prefer substrates that have not yet been determined. NPP also belongs to the alkaline phosphatase (AP) superfamily of enzymes and they are located in the cell membrane and hydrolyze extracellular phosphate diesters to affect a wide variety of biological processes. ENPP5 belongs to a group of nucleotidemetabolizing ectoenzymes, which regulate the availability of extracellular nucleotides. ENPP5 may play a role in neuronal cell communication. Hhowever, it lacks nucleotide pyrophosphatase and lysopholipase D activity. It may also be involved in neuronal cell communication. The amino acid sequence of human ENPP5 is 100%, 88%, and 82% identical to that of chimpanzee, dog and mouse/rat. ENPP5 functions in phospholipid metabolism.

  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items