Quick Order

Text Size:AAA

Mouse CD97 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD97cDNA Clone Product Information
cDNA Size:2175
cDNA Description:ORF Clone of Mus musculus CD97 antigen DNA.
Gene Synonym:TM7LN1, AA409984, Cd97
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD97 is a receptor predominantly expressed in leukocytes and belongs to a new group of seven-span transmembrane molecules, which is also designed EGF-TM7 family. The family members are characterized by an extended extracellular region with several N-terminal epidermal growth factor-like domains two of which contain a calcium binding site. Muture CD 97 has two noncovalently associated subunits and is composed of a large extracellular protein (CD97 alpha) and a seven-membrane spanning protein (CD97 beta). CD97 is considered as a defining feature of G protein-coupled receptors. The effects that lymphocytes and erythrocytes adere to CD97-transfected COS cells suggest that CD97 has the ability to bind cellular ligands. CD97 alpha has three alternatively spliced isforms that are related to the calium binding EGF-like repeats in the microfibril protein fibrillin. Leukocytes strongly positive for CD97 are concentrated at sites of inflammation relative to CD97 expression in normal lymphoid tissues.

  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Gray JX, et al. (1996) CD97 is a processed, seven-transmembrane, heterodimeric receptor associated with inflammation. The journal of Immunology. 157 (12): 5438-47.
  • Hamann J,et al. (1998) Characterization of the CD55 (DAF)-binding site on the seven-span transmembrane receptor CD97.European Journal of Immunology. 28 (5): 1701-7.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items