Quick Order

Text Size:AAA

Human NCR1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NCR1 cDNA Clone Product Information
Gene_bank_ref_id:BC064806
RefSeq ORF Size:912bp
cDNA Description:Full length Clone DNA of Homo sapiens natural cytotoxicity triggering receptor 1 with C terminal HA tag.
Gene Synonym:XXbac-BCX195L8.10-004, CD335, FLJ99094, LY94, NK-p46, NKP46, NCR1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

NCR1, also known as NK-p46 and CD335, is a natural cytotoxicity receptor(NCR). NCRs are type I transmembrane proteins with 1-2 extracellular immunoglobulin domains, a transmembrane domain containing a positively charged amino acid residue, and a short cytoplasmic tail. All are expressed almost exclusively by NK cells and play a major role in triggering NK-mediated killing of most tumor cell lines. NKp46 has two extracellular Ig-like domains followed by a ~40 residue stalk region, a type I transmembrane domain, and a short cytoplasmic tail. NKp46 has been implicated in NK cell-mediated lysis of several autologous tumor cells, pathogen-infected cell lines and mononuclear phagocytes infected with an intracellular bacterium.

References
  • Carbone E, et al. (2005) HLA class I, NKG2D, and natural cytotoxicity receptors regulate multiple myeloma cell recognition by natural killer cells. Blood. 105(1):251-8.
  • Sivori S, et al. (1997) p46, a Novel Natural Killer Cell-specific Surface Molecule That Mediates Cell Activation. J Exp Med. 186(7):1129-36.
  • Biassoni R, et al. (2004) Human natural killer cell receptors: insights into their molecular function and structure. J Cell Mol Med. 7(4):376-87.
  • Size / Price
    Catalog: HG13772-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"