After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ATL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ATL1cDNA Clone Product Information
Gene_bank_ref_id:NM_178628.5
cDNA Size:1677
cDNA Description:ORF Clone of Mus musculus atlastin GTPase 1 DNA.
Gene Synonym:Fsp1, Spg3, Adfsp, Spg3a, 4930435M24Rik, Atl1
Species:Mouse
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 50-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.

Size / Price
Catalog:MG50784-NF
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"