Quick Order

Text Size:AAA

Mouse ST6GAL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ST6GAL1cDNA Clone Product Information
cDNA Size:1212
cDNA Description:ORF Clone of Mus musculus beta galactoside alpha 2,6 sialyltransferase 1 DNA.
Gene Synonym:Siat1, St6gal, St6galI, AW742324, MGC116663, St6gal1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Beta-galactoside alpha-2,6-sialyltransferase 1, also known as B-cell antigen CD75, Sialyltransferase 1, CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase 1, ST6GAL1 and SIAT1, is a single-pass type II membrane protein which belongs to the glycosyltransferase 29 family. Sialyltransferases are key enzymes in the biosynthesis of sialoglycoconjugates that catalyze the transfer of sialic residue from its activated form to an oligosaccharidic acceptor. ST6GAL1 / SIAT1 is normally found in the?Golgi?but which can be proteolytically processed to a soluble form. It is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CDw75, and CD76. β-Galactoside α2,6-sialyltransferases ST6GAL1 and ST6GAL2 are the two unique members of the ST6GAL family described in higher vertebrates. ST6GAL1 / SIAT1 transfers sialic acid from the donor of substrate CMP-sialic acid to galactose containing acceptor substrates.

  • Collins,B.E. et al., 2006, Nat Immunol. 7(2):199-206.
  • Videira,P.A. et al., 2008, Glycoconj J. 25(3): 259-68.
  • Petit,D. et al., 2010, J Biol Chem. 285(49): 38399-414.
  • Kroes,R.A. et al., 2010, Proc Natl Acad Sci USA.107(28):12646-51.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items