Quick Order

Mouse FZD5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FZD5cDNA Clone Product Information
Gene_bank_ref_id:NM_001042659.1
cDNA Size:1758
cDNA Description:ORF Clone of Mus musculus frizzled homolog 5 (Drosophila) DNA.
Gene Synonym:Fz5, Fz-5, mFz5, AI427138, MGC141642, 5330434N09Rik, Fzd5
Species:Mouse
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Wnt Receptor Related Products
Background

Wnt signaling is involved in a variety of embryonic development processes of nonvertebrates and vertebrates, where it determines cell motility, cell polarity, differentiation, proliferation and apoptosis, as well as formation of neural synapses. Various homologs of the Wingless protein, termed WNT factors, represent key mediators and act through a receptor complex comprised of members of the Frizzled and low density lipoprotein-related receptors (LRP). 19 WNTs, 10 Frizzled, and 2 LRP proteins have been identified. Frizzled is a family of G protein-coupled receptor proteins consisting of a divergent signal peptide, a highly conserved extracellular cysteine-rich domain (CRD), a variable-length linker region, a seven-pass transmembrane domain, and a variable-length C-terminal tail.Frizzled 5 (FZD5) is believed to be the receptor for the Wnt5A ligand, and also interactions with Wnt10B, Wnt2B, and Wnt 7A functionally. Recent studies of WNT5A/Frizzled-5 signaling have revealed an unexpected and novel role in orchestrating adaptive immunity in response to microbial stimulation. In addition, FZD5 is also implicated in the survival of mature neurons in the parafascicular nucleus of the thalamus.

Size / Price
Catalog:MG50772-NF
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"