After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ENO2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ENO2 cDNA Clone Product Information
Gene_bank_ref_id:BC002745.2
RefSeq ORF Size:1305bp
cDNA Description:Full length Clone DNA of Homo sapiens enolase 2 (gamma, neuronal) with N terminal His tag.
Gene Synonym:NSE
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Pechumer H, et al. (1994) Detection of neuron-specific gamma-enolase messenger ribonucleic acid in normal human leukocytes by polymerase chain reaction amplification with nested primers. Lab Invest. 69 (6): 743-9.
  • Craig SP, et al. (1991) Localisation of neurone-specific enolase (ENO2) to 12p13. Cytogenet Cell Genet. 54 (1-2): 71-3.
  • Muley T, et al. (2003) Technical performance and diagnostic utility of the new Elecsys neuron-specific enolase enzyme immunoassay. Clin Chem Lab Med. 41 (1): 95-103.
  • Size / Price
    Catalog: HG14573-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"