After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human QPCT ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human QPCT cDNA Clone Product Information
NCBI RefSeq:BC047756
RefSeq ORF Size:1086bp
cDNA Description:Full length Clone DNA of Homo sapiens glutaminyl-peptide cyclotransferase with C terminal HA tag.
Gene Synonym:GCT, QC, sQC, QPCT
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Glutaminyl cyclase, also known as QPCT, can promote the N-terminal cyclization reaction of N-terminal pyroglutamate(pGlu). The pGlu formation from its glutaminyl precursor is required in the maturation of numerous bioactive peptides, while the aberrant formation of pGlu may be related to several pathological processes, such as osteoporosis and amyloidotic diseases. Glutaminyl cyclase's structure reveals an alpha/beta scaffold akin to that of two-zinc exopeptidases but with several insertions and deletions, particularly in the active-site region. Glutaminyl cyclase's amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. It is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.

References
  • Busby WH, et al. (1987) An enzyme(s) that converts glutaminyl-peptides into pyroglutamyl-peptides. Presence in pituitary, brain, adrenal medulla, and lymphocytes. J Biol Chem. 262(18):8532-6.
  • Bateman RC, et al. (2001) Evidence for essential histidines in human pituitary glutaminyl cyclase. Biochemistry. 40(37):11246-50.
  • Schilling S, et al. (2002) Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity. Biochemistry. 41 (35):10849-57.
  • Size / Price
    Catalog: HG13752-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"