Quick Order

Text Size:AAA

Human TMEM25 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TMEM25 cDNA Clone Product Information
Gene_bank_ref_id:BC051841
RefSeq ORF Size:969bp
cDNA Description:Full length Clone DNA of Homo sapiens transmembrane protein 25 with C terminal HA tag.
Gene Synonym:UNQ2531/PRO6030, FLJ14399, TMEM25
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TMEM25 is a novel member of the immunoglobulin superfamily. Immunoglobulin superfamily members are implicated in immune responses, growth factor signaling, and cell adhesion. TMEM25 contains 1 Ig-like (immunoglobulin-like) domain and is a target of pharmacogenomics in the field of oncology and regenerative medicine. TMEM25 isoform 1, consisting of exons 1-9, encoded a 366-aa transmembrane protein. TMEM25 isoform 2, consisting of exons 1-4 and 6-9, encoded a 322-aa secreted protein. TMEM25 mRNA was expressed in brain, including cerebellar cortex and hippocampus, as well as in neuroblastoma, brain tumors, and gastric cancer. Human TMEM25 gene was located at the 11q23.3 oncogenomic recombination hotspot around the MLL amplicon and the neuroblastoma deleted region.

References
  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200(1-2):149-56.
  • Sugano S, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Katoh M, et al. (2004) Identification and characterization of human TMEM25 and mouse Tmem25 genes in silico. Oncol Rep. 12(2):429-33.
  • Size / Price
    Catalog: HG13750-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"