Quick Order

Text Size:AAA

Human GABARAPL2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GABARAPL2 cDNA Clone Product Information
Gene_bank_ref_id:NM_007285.6
RefSeq ORF Size:354bp
cDNA Description:Full length Clone DNA of Homo sapiens GABA(A) receptor-associated protein-like 2 with N terminal His tag.
Gene Synonym:ATG8, GEF2, ATG8C, GEF-2, GATE16, GATE-16
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

References
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Catalog: HG14563-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"