After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CRIPT ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CRIPT cDNA Clone Product Information
Gene_bank_ref_id:BC006980
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Homo sapiens cysteine-rich PDZ-binding protein with N terminal His tag.
Gene Synonym:HSPC139
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

References
  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • Size / Price
    Catalog: HG14560-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"