Quick Order

Human LSM3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LSM3 cDNA Clone Product Information
Gene_bank_ref_id:BC007055
RefSeq ORF Size:309bp
cDNA Description:Full length Clone DNA of Homo sapiens LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) with N terminal His tag.
Gene Synonym:SMX4, USS2, YLR438C
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

LSM3 is a member of the snRNP Sm proteins family. Sm-like proteins can be detected in a variety of organisms. They all have the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM3binds specifically to the 3'-terminal U-tract of U6 snRNA.

References
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Lehner B. et al., 2004, Genome Res. 14 (7): 1315-23.
  • Lehner B. et al., 2004, Genomics. 83 (1): 153-67.
  • Size / Price
    Catalog: HG14554-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"