Quick Order

Text Size:AAA

Mouse LILRB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LILRB3cDNA Clone Product Information
cDNA Size:2526
cDNA Description:ORF Clone of Mus musculus leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 DNA.
Gene Synonym:Gp91, Pirb, Lilrb3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Leukocyte immunoglobulin-like receptor subfamily B member 3, also known as Leukocyte immunoglobulin-like receptor 3, Immunoglobulin-like transcript 5, Monocyte inhibitory receptor HL9, CD85 antigen-like family member A, CD85a and LILRB3, is a single-pass type I  membrane protein which belongs to the leukocyte receptor cluster (LRC) present on 19q13.4. LILRB3 / CD85a contains four Ig-like C2-type (immunoglobulin-like) domains. LILRB3 / CD85a contains three copies of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases. LILRB3 / CD85a is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found.

  • Huang,J. et al., 2010, J Virol. 84 (18): 9463-71.
  • Arm J.P. et al., 1997, J. Immunol. 159:2342-2349.
  • Wende H. et al., 2000, Immunogenetics 51:703-713.
  • Yu L.-R. et al., 2007,J. Proteome Res. 6:4150-4162.