Quick Order

Rat SFN Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SFNcDNA Clone Product Information
Gene_bank_ref_id:XM_001065560.3
cDNA Size:747
cDNA Description:ORF Clone of Rattus norvegicus stratifin DNA.
Gene Synonym:Sfn
Species:Rat
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

14-3-3 protein sigma (YWHAS), also known as stratifin (SFN) and epithelial cell marker protein 1, is a member of the14-3-3 proteins which are a family of conserved regulatory molecules expressed in all eukaryotic cells. The name 14-3-3 refers to the particular elution and migration pattern of these proteins on DEAE-cellulose chromatography and starch-gel electrophoresis. The 14-3-3 proteins eluted in the 14th fraction of bovine brain homogenate and were found on positions 3.3 of subsequent electrophoresis. There are seven genes that encode 14-3-3s in most mammals. 14-3-3 proteins have been identified as adapter proteins implicated in the regulation of a large spectrum of both general and specialized signaling pathway. More than 100 signaling proteins have been reported as 14-3-3 ligands including kinases, phosphatases, and transmembrane receptors, and the binding generally results in the modulation of the activity of the binding partner. YWHAE exists as a homodimer and present mainly in tissues enriched in stratified squamous keratinising epithelium. YWHAS has been repoted to interact with KRT17 and GAB2, and may regulate protein synthesis and epithelial cell growth by stimulating Akt/mTOR pathway upon binding to KRT17. Additionally, YWHAS (SFN) may also act as a p53-regulated inhibitor of G2/M progression.

Size / Price
Catalog:RG80554-CM
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"