Quick Order

Text Size:AAA

Human AMIGO2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AMIGO2cDNA Clone Product Information
Gene_bank_ref_id:BC047595
cDNA Size:1569
cDNA Description:ORF Clone of Homo sapiens adhesion molecule with Ig-like domain 2 DNA.
Gene Synonym:ALI1, DEGA, AMIGO2
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It belongs to the immunoglobulin superfamily, AMIGO family. AMIGO2 may mediate homophilic as well as heterophilic cell-cell interaction with AMIGO1 or AMIGO3. It is required for depolarization-dependent survival of cultured cerebellar granule neurons. AMIGO2 may also contribute to signal transduction through its intracellular domain. It may play a role in the tumorigenesis of a subset of gastric adenocarcinomas. AMIGO2 is highly expressed in breast, ovary, cervix, and uterus.

References
  • Rouhiainen A, et al. (2003) AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats. J Cell Biol. 160:963-73.
  • Kikkawa Y, et al. (2003) Alivin 1, a novel neuronal activity-dependent gene, inhibits apoptosis and promotes survival of cerebellar granule neurons. J Neurosci. 23:5887-96.
  • Bassi R, et al. (2004) DEGA/AMIGO-2, a leucine-rich repeat family member, differentially expressed in human gastric adenocarcinoma: effects on ploidy, chromosomal stability, cell adhesion/migration and tumorigenicity. Oncogene 23:5056-67.
  • Size / Price
    Catalog:HG13735-CY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"