Quick Order

Text Size:AAA

Mouse SELP Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SELPcDNA Clone Product Information
cDNA Size:2307
cDNA Description:ORF Clone of Mus musculus selectin, platelet DNA.
Gene Synonym:Grmp, CD62P, PADGEM, MGC129336, MGC129337, P-selectin, Selp
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

P selectin (SELP) is a 140kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. SELP mediates rapid rolling of leukocyte rolling over vascular surfaces during the initial steps in inflammation through interaction with PSGL1. P selectin is a cell adhesion molecule on the surface of activated endothelial cells. Cellular adhesion molecules are a large family of proteins that attach the cytoskeleton and intracellular signaling cascades with the extracellular environment. SELP is a calcium-dependent receptor for myeloid cells that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interacton of activated endothelial cells or platelets with leukocytes.

  • Johnson-Tidey RR, et al. (1994) Increase in the adhesion molecule P-selectin in endothelium overlying atherosclerotic plaques. Coexpression with intercellular adhesion molecule-1. Am J Pathol. 144(5):952-61.
  • Walcheck B, et al. (1996) Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1. A mechanism that amplifies initial leukocyte accumulation of P-selectin in vitro. J Clin Invest. 98(5):1081-7.
  • Foreman KE, et al. (1994) C5a-induced expression of P-selectin in endothelial cells. J Clin Invest. 94(3):1147-55.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks