After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CPLX3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CPLX3 cDNA Clone Product Information
Gene_bank_ref_id:BC018026
RefSeq ORF Size:477bp
cDNA Description:Full length Clone DNA of Homo sapiens complexin 3 with N terminal His tag.
Gene Synonym:CPXIII, CPX-III, Nbla11589
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CPLX3, also known as complexin 3, belongs to the complexin/synaphin family. As a SNARE-binding protein, complexin (CPX), can act either as a facilitator or as an inhibitor of membrane fusion, constituting a controversial dilemma. CPX acts sequentially on assembling SNAREpins, first facilitating zippering by nearly doubling the distance at which v- and t-SNAREs can engage and then clamping them into a half-zippered fusion-incompetent state. Specifically, the central helix of CPX allows SNAREs to form this intermediate energetic state at 9-15 nm but not when the bilayers are closer than 9 nm. Stabilizing the activated-clamped state at separations of less than 9 nm requires the accessory helix of CPX, which prevents membrane-proximal assembly of SNAREpins. CPLX3 binds to the SNARE core complex containing SNAP25, VAMP2 and STX1A.

References
  • Newton-Cheh C. et al., 2009, Nat Genet. 41(6): 666-76.
  • Li F. et al., 2011, Nat Struct Mol Biol. 18 (8): 941-6.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • Size / Price
    Catalog: HG14518-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"