After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FGF12cDNA Clone Product Information
cDNA Size:732
cDNA Description:ORF Clone of Mus musculus fibroblast growth factor 12,transcript variant 1 DNA.
Gene Synonym:Fhf1, AV114868, Fgf12
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50678-ACG$325
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50678-ACR$325
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50678-ANG$325
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50678-ANR$325
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50678-CF$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50678-CH$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50678-CM$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50678-CY$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)MG50678-M$95
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-taggedMG50678-M-Y$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50678-NF$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50678-NH$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50678-NM$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50678-NY$295
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50678-UT$295
 Learn more about expression Vectors
Fibroblast Growth Factor (FGF) & Receptor Related Products
Product nameProduct name
Cynomolgus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human aFGF / FGF1 ProteinHuman bFGF / FGF2 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF10 ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGF21 Protein (His Tag)Human FGFBP3 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinHuman FGF18 / FGF-18 Protein (His Tag)Human FGF14 / SCA27 Protein (isoform 1B)Cynomolgus FGFR3 Protein (Fc Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse / Rat aFGF / FGF1 ProteinMouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Canine aFGF / FGF1 ProteinCanine FGF12 ProteinRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus aFGF / FGF1 ProteinCynomolgus FGFR1 / CD331 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.