After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PAX8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PAX8cDNA Clone Product Information
Gene_bank_ref_id:BC001060
cDNA Size:1353
cDNA Description:ORF Clone of Homo sapiens paired box 8 DNA.
Gene Synonym:PAX8
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

PAX8 gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically encode proteins which contain a paired box domain, an octapeptide, and a paired-type homeodomain. PAX8 is involved in thyroid follicular cell development and expression of thyroid-specific genes. Also functions in very early stages of kidney organogenesis. Mutations in PAX8 gene have been associated with thyroid dysgenesis, thyroid follicular carcinomas and atypical follicular thyroid adenomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

References
  • Poleev A. et al., 1995, Eur J Biochem. 228 (3): 899-911
  • Poleev A. et al., 1993, Development. 116 (3): 611-23.
  • Di Palma. et al., 2003, J Biol Chem. 278 (5): 3395-402.
  • Size / Price
    Catalog:HG14505-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"