After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PMP2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PMP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_002677.3
RefSeq ORF Size:399bp
cDNA Description:Full length Clone DNA of Homo sapiens peripheral myelin protein 2 with N terminal HA tag.
Gene Synonym:P2, MP2, FABP8, M-FABP, PMP2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Myelin P2 protein, also known as PMP2, is a cytosolic protein found primarily in peripheral nerves. It Belongs to the calycin superfamily. Fatty-acid binding protein (FABP) family. PMP2 is a small, basic, and cytoplasmic lipid binding protein of peripheral myelin. It is similar in amino acid sequence and tertiary structure to fatty acid binding proteins found in the liver, adipocytes, and intestine, its expression is limited to the nervous system. PMP2 is detected only in myelin-producing cells of the central and peripheral nervous systems, the oligodendrocytes and Schwann cells, respectively. PMP2 may play a role in lipid transport protein in Schwann cells. It forms a beta-barrel structure that accommodates hydrophobic ligands in its interior.

References
  • Hayasaka, K. et al., 1993, Genomics. 18 (2): 244-8.
  • Polverini, E. et al., 2006, J Struct Biol. 153 (3): 253-63.
  • Gould,R.M. et al., 2008, Neuron Glia Biol. 4 (2):137-52.
  • Size / Price
    Catalog: HG11426-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"