Quick Order

Mouse GAD2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GAD2 cDNA Clone Product Information
Gene_bank_ref_id:NM_008078.2
RefSeq ORF Size:1758bp
cDNA Description:Full length Clone DNA of Mus musculus glutamic acid decarboxylase 2 with C terminal Flag tag.
Gene Synonym:GAD65, Gad-2, GAD(65), 6330404F12Rik, Gad2
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Mouse glutamate decarboxylase 2, also known as glutamate decarboxylase 65 kDa isoform, 65 kDa glutamic acid decarboxylase, GAD2 and GAD65, is a member of the group II decarboxylase family. GAD2 is identified as a major autoantigen in insulin-dependent diabetes. GAD2 is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. GAD2 may also play a role in the stiff man syndrome. GAD2 is implicated in the formation of the gamma-aminobutyric acid (GABA), a neurotransmitter involved in the regulation of food intake. GABA is synthesized in brain by two isoforms of glutamic acid decarboxylase (Gad), GAD1 and GAD2. GAD1 provides most of the GABA in brain, but GAD2 can be rapidly activated in times of high GABA demand. Mice lacking GAD2 are viable whereas deletion of GAD1 is lethal. Deletion of GAD2 increased ethanol palatability and intake and slightly reduced the severity of ethanol-induced withdrawal.

Size / Price
Catalog: MG50653-CF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"