After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat IL20 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL20cDNA Clone Product Information
cDNA Size:531
cDNA Description:ORF Clone of Rattus norvegicus interleukin 20 DNA.
Gene Synonym:Il20
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

IL-10 Family & Receptor Related Products

IL20/Interleukin-20 belongs to the IL-10 family. It is a cytokine structurally related to interleukin 10. IL20/Interleukin-20 can be detected in skin, trachea, and other tissues. It is produced by activated keratinocytes and monocytes and transmits an intracellular signal through two distinct cell-surface receptor complexes on keratinocytes and other epithelial cells.It has been shown that interleukin-20 transduce its signal through signal transducer and activator of transcription 3 (STAT3) in keratinocytes. It may be involved in epidermal function and psoriasis. It also regulates proliferation and differentiation of keratinocytes during inflammation, particularly inflammation associated with the skin. In addition, IL20/Interleukin-20 also causes cell expansion of multipotential hematopoietic progenitor cells. A specific receptor for this cytokine is found to be expressed in skin and upregulated dramatically in psoriatic skin, suggesting a role for this protein in epidermal function and psoriasis.

  • Chen XY, et al. (2011) The association between the IL-20-1723CG allele on the 1q chromosome and psoriasis triggered or exacerbated by an upper respiratory tract infection in the Chinese Han population. Dermatology. 222(1):24-30.
  • Baird AM, et al. (2011) IL-20 is epigenetically regulated in NSCLC and down regulates the expression of VEGF. Eur J Cancer. 47(12):1908-18.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks