Quick Order

Text Size:AAA

Human SULT2B1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SULT2B1cDNA Clone Product Information
cDNA Size:1098
cDNA Description:ORF Clone of Homo sapiens sulfotransferase family, cytosolic, 2B, member 1 DNA.
Gene Synonym:HSST2, SULT2B1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human SULT2B1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

Sulfotransferase family cytosolic 2B member 1, also known as Sulfotransferase 2B1, ST2B1, Alcohol sulfotransferase, Hydroxysteroid sulfotransferase 2, SULT2B1 and HSST2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. The human hydroxysteroid sulfotransferase (SULT) family is comprised of two subfamilies, SULT2A1 and SULT2B1. SULT2B1 is expressed highly in placenta, prostate and trachea. A lesser expression of SULT1B1 was observed in the small intestine and lung. SULT2B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT2B1 sulfates hydroxysteroids like DHEA. Isoform 1 preferentially sulfonates cholesterol. The two SULT2B1 isoforms, SULT2B1a and SULT2B1b, are encoded by a single gene as a result of alternative transcription initiation and alternative splicing. SULT2B1b catalyzes the sulfonation of 3beta-hydroxysteroid hormones and cholesterol, whereas SULT2B1a preferentially catalyzes pregnenolone sulfonation.

  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Geese,WJ. et al., 2001,Biochem Biophys Res Commun.288 (1): 280-9.
  • Shimizu,C. et al., 2003, Endocrinology. 144 (4):1186-93.
  • Ji,Y. et al., 2007, J Pharmacol Exp Ther. 322 (2): 529-40.