After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat CD302 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD302 cDNA Clone Product Information
Gene_bank_ref_id:NM_001013916.1
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Rattus norvegicus CD302 molecule with C terminal Myc tag.
Gene Synonym:MGC108799, RGD1307606, Cd302
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CD302/CLEC13A (C-type lectin domain family 13 member A), also known as C-type lectin receptor DCL-1, is a type I transmembrane C-type lectin DCL-1/CD302. DCL-1 protein was highly conserved among the human, mouse, and rat orthologs. DCL-1 ectodomain contains only one CRD, whereas other type I transmembrane C-type lectins contain more than one domain (e.g. selectins and MMR). DCL-1 CP contains several putative motifs, including a Tyr-based internalization, a cluster of acidic amino acids, and Ser and Tyr phosphorylation motifs, suggesting that DCL-1 CP mediates not only endocytosis and late endosome targeting but also signaling. DCL-1 may be another cell/matrix adhesion receptor integrated in cell adhesion complexes and that DCL-1 dysfunction may affect APC adhesion and migration, causing suppression of APC function.

References
  • Kato M, et al. (2007) The novel endocytic and phagocytic C-Type lectin receptor DCL-1/CD302 on macrophages is colocalized with F-actin, suggesting a role in cell adhesion and migration. J Immunol. 179(9): 6052-63.
  • Skinnider BF, et al. (2002) The role of cytokines in classical Hodgkin lymphoma. Blood. 99(12): 4283-97.
  • Size / Price
    Catalog: RG80414-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"