After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PPP3R1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PPP3R1 cDNA Clone Product Information
Gene_bank_ref_id:NM_000945.3
RefSeq ORF Size:513bp
cDNA Description:Full length Clone DNA of Homo sapiens protein phosphatase 3, regulatory subunit B, alpha with C terminal HA tag.
Gene Synonym:CNB, CNB1, CALNB1, PPP3R1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PPP3R1 belongs to the calcineurin regulatory subunit family. It is a regulatory subunit of calcineurin. Calcineurin is composed of two subunits: calcineurin A (CnA) and calcineurin B (CnB). Dephosphorylation of the nuclear factor of activated T-cells (NF-AT) by Calcineurin is essential for NF-AT activation, nuclear translocation, and early gene expression in T-cells. PPP3R1 is a Ser/Thr-specific calcium and calmodulin-dependent protein phosphatase which takes a vital part in the T cell activation pathway. PPP3R1 is involved in protein dephosphorylation, NFAT protein import into nucleus (ortholog) and epithelial to mesenchymal transition (ortholog). It participates in calcineurin signaling pathway; mitogen activated protein kinase signaling pathway. PPP3R1 interacts with (+)-pilocarpine, 2,4-dinitrotoluene and ammonium chloride. It contains four EF-hand domains and four functional calcium-binding sites. PPP3R1 play an improtant role in the T cell activation pathway.

References
  • Feng B, et al. (1999) Interactions of calcineurin A, calcineurin B, and Ca2+. Biochemistry 38 (38): 12481-9.
  • Kawamura A, et al. (1995) Interaction of FKBP12-FK506 with calcineurin A at the B subunit-binding domain. J Biol Chem. 270(26):15463-6.
  • Wang MG, et al. (1997) Calcineurin A alpha (PPP3CA), calcineurin A beta (PPP3CB) and calcineurin B (PPP3R1) are located on human chromosomes 4, 10q21q22 and 2p16p15 respectively. Cytogenet Cell Genet. 72(2-3):236-41.
  • Size / Price
    Catalog: HG13673-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"