After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NMNAT2 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human NMNAT2 cDNA Clone Product Information
NCBI RefSeq:NM_015039.2
RefSeq ORF Size:924bp
cDNA Description:Full length Clone DNA of Homo sapiens nicotinamide nucleotide adenylyltransferase 2 with N terminal HA tag.
Gene Synonym:PNAT2, C1orf15, MGC2756, KIAA0479, NMNAT2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

NMNAT2, also known as NMNAT-2, belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family. NMNAT is a central enzyme in NAD+ biosynthesis, transferring the adenylyl moiety of ATP to nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) resulting in the formation of NAD+ or NaAD+ and the release of pyrophosphate. NMNAT2 is predominantly expressed in human pancreas, insulinoma as well as in the brain, especially in the cerebrum, cerebellum, occipital lobe, frontal lobe, temporal lobe and putamen. Immunofluorescence microscopy localized endogenous NMNAT2 to the Golgi apparatus in human cell line. Endogenous NMNAT2 seem to be a labile axon survival factor, because specific depletion of NMNAT2 is sufficient to induce Wallerian-like degeneration of uninjured axons which endogenous NMNAT1 and NMNAT3 cannot prevent. Thus endogenous NMNAT2 represents an exciting new therapeutic target for axonal disorders.

References
  • Ljungberg MC. et al., 2012, Hum Mol Genet. 21 (2): 251-67.
  • Seki N. et al., 1998, DNA Res. 4 (5): 345-9.
  • Raffaelli N. et al., 2002, Biochem Biophys Res Commun. 297 (4): 835-40.
  • Sood R. et al., 2001, Genomics. 73 (2): 211-22.
  • Size / Price
    Catalog: HG11399-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"