After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CLEC4A3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4A3cDNA Clone Product Information
Gene_bank_ref_id:NM_001005891.1
cDNA Size:714
cDNA Description:ORF Clone of Rattus norvegicus C-type lectin domain family 4, member A3 DNA.
Gene Synonym:Dcir3, Clec4a3
Species:Rat
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

CLEC4A3 contains 1 C-type lectin domain and belongs to the C-type lectin-like domain-containing (CLEC) family. Lectins are proteins that are able to recognize and bind with specific carbohydrate molecules. C-type lectins are an important group of proteins found in the immune system of animals. These lectins are named C-type because of their calcium dependent carbohydrate recognition domain (CRD). In the immune system, C-type lectins act as recognition molecules by binding to foreign microorganisms. They also promote the movement and selective adhesion of white blood cells.

The C-type lectin has a three-dimensional fold, the CRD, in which calcium ions contribute to the lectin's ability to recognize and bind carbohydrates. In the immune system, carbohydrate recognition contributes to the ability of immune cells to move from one area of the body to another. It also allows immune cells to identify and discriminate between proteins that belong to the host and those that belong to foreign organisms. There are a number of different C-type lectin subfamilies, including collectins, selectins, proteoglycans, and lymphocyte lectins.

References
  • Gibbs RA, et al. (2004) Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature. 428:493-521.
  • Carninci P, et al. (1999) High-efficiency full-length cDNA cloning. Methods Enzymol. 303:19-44.
  • Shibata K, et al. (2000) RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer. Genome Res. 10:1757-71.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"