Quick Order

Text Size:AAA

Mouse SEMA3A ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SEMA3A cDNA Clone Product Information
Gene_bank_ref_id:NM_009152.3
RefSeq ORF Size:2319bp
cDNA Description:Full length Clone DNA of Mus musculus sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A with C terminal Flag tag.
Gene Synonym:SemD, SEMA1, Semad, coll-1, Hsema-I, Sema3a
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Semaphorins are a family of secreted and cell-bound signaling molecules defined by the presence of a common 500 aa Sema domain. They are best characterized in relation to axon guidance during development of the nervous system. The functions of Semaphorins 3A (SEMA3A) are mediated primarily through binding to the Neuropilin-1 (Npn-1) and Plexin-A1 coreceptor complex. Neuropilins lack a signaling-competent cytoplasetmic domain and ensure semaphorin binding, whereas the transmembrane receptor plexin mediates the intracellular response. As the first identified vertebrate semaphorin, SEMA3A functions either as a chemorepulsive agent inhibiting axonal outgrowth, or as a chemoattractive agent stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Its overexpression is associated with schizophrenia which is seen in various human tumor cell lines, and aberrant release is associated with the progression of Alzheimer's disease

References
  • Giordano,A. et al., 2003, J Neurocytol.32(4):345-352.
  • Good, P. F. et al., 2005, J. Neurochem.91(3): 716-736.
  • Gu, C. et al., 2005, Science.307(5707): 265–268.
  • Chadborn,N.H. et al., 2006, J Cell Sci.119(Pt 5):951-957.
  • Schmidt,E.F. et al., 2007, Adv Exp Med Biol.600:1-11.
  • Size / Price
    Catalog: MG50631-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"