Quick Order

Rat LAG3 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat LAG3 cDNA Clone Product Information
NCBI RefSeq:NM_212513.2
RefSeq ORF Size:1578bp
cDNA Description:Full length Clone DNA of Rattus norvegicus lymphocyte-activation gene 3 with C terminal Myc tag.
Gene Synonym:CD223, MGC108901, Lag3
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

LAG3, also known as CD223 and Lymphocyte activation gene 3, belongs to immunoglobulin (Ig) superfamily. LAG3 contains 4 extracellular Ig-like domains. The LAG3 gene contains 8 exons. It is selectively expressed in activated T and NK cells. LAG3 has a negative regulatory function in T cells. It also acts as as a new marker of T cell induced B cell activation. As a soluble molecule, LAG3 activates antigen-presenting cells through MHC class II signalling, leading to increased antigen-specific T-cell responses in vivo.

References
  • Sigrid Hannier. et al., 1998, The Journal of Immunology. 161(8): 4058-65.
  • Triebel F. et al., 1990, J Exp Med. 171 (5): 1393-405.
  • Baixeras E. et al., 1992, J Exp Med. 176 (2): 327-37.
  • Huard B. et al., 1997, Proc Natl Acad Sci. 94 (11): 5744-9.
  • Kisielow M. et al., 2005, Eur J Immunol. 35 (7): 2081-8.
  • Size / Price
    Catalog: RG80367-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"