After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human GALK1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GALK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_000154.1
RefSeq ORF Size:1179bp
cDNA Description:Full length Clone DNA of Homo sapiens galactokinase 1 with N terminal HA tag.
Gene Synonym:GK1, GALK, GALK1
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Galactokinase, also known as Galactose kinase, GALK and GALK1, is a protein which belongs to the GHMP kinase family and GalK subfamily. Galactokinase / GALK1 is a major enzyme for galactose metabolism. Galactokinase (GALK) deficiency is an autosomal recessive disorder characterized by elevation of blood galactose concentration and diminished galactose-1-phosphate, leading to the production of galactitol. Defects in GALK1 are the cause of galactosemia II ( GALCT2 ) which II is an autosomal recessive deficiency characterized by congenital cataracts during infancy and presenile cataracts in the adult population. The cataracts are secondary to accumulation of galactitol in the lenses.

References
  • Hunter,M. et al., 2001, Hum Mutat. 17 (1):77-8.
  • Park,H.D. et al., 2007, Mol Genet Metab. 91 (3):234-8.
  • Park,H.D. et al., 2009, BMC Med Genet. 10 :29.
  • Size / Price
    Catalog: HG11383-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"