Quick Order

Text Size:AAA

Mouse GAD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GAD2cDNA Clone Product Information
cDNA Size:1758
cDNA Description:ORF Clone of Mus musculus glutamic acid decarboxylase 2 DNA.
Gene Synonym:GAD65, Gad-2, GAD(65), 6330404F12Rik, Gad2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Mouse glutamate decarboxylase 2, also known as glutamate decarboxylase 65 kDa isoform, 65 kDa glutamic acid decarboxylase, GAD2 and GAD65, is a member of the group II decarboxylase family. GAD2 is identified as a major autoantigen in insulin-dependent diabetes. GAD2 is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. GAD2 may also play a role in the stiff man syndrome. GAD2 is implicated in the formation of the gamma-aminobutyric acid (GABA), a neurotransmitter involved in the regulation of food intake. GABA is synthesized in brain by two isoforms of glutamic acid decarboxylase (Gad), GAD1 and GAD2. GAD1 provides most of the GABA in brain, but GAD2 can be rapidly activated in times of high GABA demand. Mice lacking GAD2 are viable whereas deletion of GAD1 is lethal. Deletion of GAD2 increased ethanol palatability and intake and slightly reduced the severity of ethanol-induced withdrawal.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items