Quick Order

Text Size:AAA

Human COCH Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
COCHcDNA Clone Product Information
cDNA Size:1653
cDNA Description:ORF Clone of Homo sapiens coagulation factor C homolog, cochlin (Limulus polyphemus) DNA.
Gene Synonym:DFNA9, COCH5B2, COCH-5B2, COCH
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Cochlin, also known as COCH-5B2 and COCH, is a secreted protein which contains one LCCL domain and two VWFA domains. It is an abundant inner ear protein expressed as multiple isoforms. Its function is also unknown, but it is suspected to be an extracellular matrix component. Cochlin and type II collagen are major constituents of the inner ear extracellular matrix, and Cochlin constitutes 70% of non-collagenous protein in the inner ear, the cochlin isoforms can be classified into three subgroups, p63s, p44s and p40s. The expression of cochlin is highly specific to the inner ear. Eleven missense mutation and one in-frame deletion have been reported in the COCH gene, causing hereditary progressive sensorineural hearing loss and vestibular dysfunction, deafness autosomal dominant type 9 (DFNA9). The co-localization of cochlin and type II collagen in the fibrillar substance in the subepithelial area indicate that cochlin may play a role in the structural homeostasis of the vestibule acting in concert with the fibrillar type II collagen bundles. Defects in COCH may contribute to Meniere disease which is an autosomal dominant disorder characterized by hearing loss associated with episodic vertigo.

  • Ikezono T, et al. (2005) Expression of cochlin in the vestibular organ of rats. ORL J Otorhinolaryngol Relat Spec. 67(5): 252-8.
  • Shindo S, et al. (2008) Spatiotemporal expression of cochlin in the inner ear of rats during postnatal development. Neurosci Lett. 444(2): 148-52.
  • Hosokawa S, et al. (2010) Ultrastructural localization of cochlin in the rat cochlear duct. Audiol Neurootol. 15(4): 247-53.