After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BTKcDNA Clone Product Information
Gene_bank_ref_id:NM_013482.2
cDNA Size:1980
cDNA Description:ORF Clone of Mus musculus Bruton agammaglobulinemia tyrosine kinase DNA.
Gene Synonym:xid, AI528679, Btk
Species:Mouse
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50607-ACG$345
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50607-ACR$345
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50607-ANG$345
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50607-ANR$345
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50607-CF$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50607-CH$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50607-CM$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50607-CY$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone)MG50607-M$195
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50607-NF$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50607-NH$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50607-NM$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50607-NY$315
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50607-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

References
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • Size / Price
    Catalog:MG50607-CF
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"