After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat IFNGR1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat IFNGR1 cDNA Clone Product Information
NCBI RefSeq:NM_053783.1
RefSeq ORF Size:1395bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interferon gamma receptor 1 with C terminal Myc tag.
Gene Synonym:Ifngr, Ifngr1
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinRhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human IFNA4 Protein (His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Cynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rhesus IFNG / Interferon Gamma ProteinHuman IL-28B / IFN-lambda-3 Protein (His Tag)Human IFN-alpha / IFNA1 / IFN Protein (His Tag)Human Interferon alpha-B / IFNA8 Protein (His Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNGR2 Protein (His Tag)Mouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human Interferon alpha 10 / IFNA10 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Rat IFNA5 / IFNaG Protein (His Tag)Human Interferon beta / IFN-beta / IFNB ProteinCynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rhesus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinCynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Rhesus IFNAR1 / IFNAR Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinCynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Human Interferon alpha-B / IFNA8 ProteinFerret IFNG / Interferon Gamma Protein (His Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Rhesus IFNA2 / Interferon alpha 2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Rhesus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Rhesus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)Rhesus IFNAR1 / IFNAR ProteinRhesus IFN gamma Protein (His Tag)
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD119 (cluster of differentiation 119), also known as IFNGR1 ( interferon gamma receptor 1), is part of the heterodimeric gamma interferon receptor which consists of IFNGR1 (CD119) and IFNGR2. The IFNGR1 gene encodes the ligand-binding chain (alpha) of the interteron receptor while IFNGR gene encodes the non-ligand binding partner. The ability of the interferon-γ was achieved through binding to the interferon receptor CD119. After binding, the products of activated T-lymphocytes interferon-γ exerts antiviral activity, growth inhibitory effect, and several immune- regulatory activities on a variety of cell types.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Novick D, et al. (1987) The human interferon-gamma receptor. The journal of biological chemistry. 262 (18): 8483-7
  • Size / Price
    Catalog: RG80328-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"