Quick Order

Text Size:AAA

Human ABHD10 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ABHD10 cDNA Clone Product Information
NCBI RefSeq:BC014516
RefSeq ORF Size:921bp
cDNA Description:Full length Clone DNA of Homo sapiens abhydrolase domain containing 10 with N terminal His tag.
Gene Synonym:ABHD10
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Mycophenolic acid (MPA), the active metabolite of the immunosuppressant mycophenolate mofetil (MMF), is primarily metabolized by glucuronidation to a phenolic glucuronide (MPAG) and an acyl glucuronide (AcMPAG). It is known that AcMPAG, which may be an immunotoxic metabolite, is deglucuronidated in human liver. AcMPAG deglucuronidation activity was detected in both human liver cytosol (HLC) and microsomes (HLM). By purification from HLC with column chromatographic purification steps, the enzyme responsible for AcMPAG deglucuronidationis identified as α/β hydrolase domain containing 10 (ABHD10). Recombinant ABHD10 expressed in Sf9 cells efficiently deglucuronidated AcMPAG with a K(m) value of 100.7 ± 10.2 μM, which was similar to those in HLM, HLC, and human liver homogenates (HLH). Immunoblot analysis revealed ABHD10 protein expression in both HLC and HLM. The AcMPAG deglucuronidation by recombinant ABHD10, HLC, and HLH were potently inhibited by AgNO(3), CdCl(2), CuCl(2), PMSF, bis-p-nitrophenylphosphate, and DTNB. The CL(int) value of AcMPAG formation from MPA, which was catalyzed by human UGT2B7, in HLH was increased by 1.8-fold in the presence of PMSF. Thus, human ABHD10 would affect the formation of AcMPAG, the immunotoxic metabolite.

References
  • Nardini M. et al., 1999, Curr Opin Struct Biol. 9 (6): 732-7.
  • Carr PD. et al., 2009, Protein Pept Lett. 16 (10): 1137-48.
  • Cheah E. et al., 1992, Protein Eng. 5 (3): 197-211.
  • Iwamura A. et al., 2012, J Biol Chem. 287 (12): 9240-9.
  • Size / Price
    Catalog: HG14439-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"